ID: 1079173135_1079173139

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1079173135 1079173139
Species Human (GRCh38) Human (GRCh38)
Location 11:18115146-18115168 11:18115167-18115189
Sequence CCAGTAGAACCACCATCAAGGTA TAATTCACTGTAGGTTTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110} {0: 1, 1: 0, 2: 0, 3: 14, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!