ID: 1079173135_1079173140

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1079173135 1079173140
Species Human (GRCh38) Human (GRCh38)
Location 11:18115146-18115168 11:18115168-18115190
Sequence CCAGTAGAACCACCATCAAGGTA AATTCACTGTAGGTTTTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110} {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!