ID: 1079175512_1079175517

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1079175512 1079175517
Species Human (GRCh38) Human (GRCh38)
Location 11:18136801-18136823 11:18136853-18136875
Sequence CCAGTCCTGGTCATGAGGGTGTC TCCACCTGAGAGAAAATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 105} {0: 2, 1: 2, 2: 1, 3: 16, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!