ID: 1079181309_1079181312

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1079181309 1079181312
Species Human (GRCh38) Human (GRCh38)
Location 11:18196152-18196174 11:18196192-18196214
Sequence CCACTCCTAGTCATGGGGGTGTC TTTCTGAATTCCTGCACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 99} {0: 1, 1: 1, 2: 3, 3: 26, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!