ID: 1079184276_1079184278

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1079184276 1079184278
Species Human (GRCh38) Human (GRCh38)
Location 11:18221915-18221937 11:18221937-18221959
Sequence CCATATGTCTTTCTTTTACTTCC CAAGTGTCACACTGCTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 99, 4: 1086} {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!