ID: 1079226931_1079226935

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1079226931 1079226935
Species Human (GRCh38) Human (GRCh38)
Location 11:18614883-18614905 11:18614910-18614932
Sequence CCACGAGAGCTGCCCAAGGGTCT GAACTAACTGAACCACTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101} {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!