ID: 1079249947_1079249954

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1079249947 1079249954
Species Human (GRCh38) Human (GRCh38)
Location 11:18780093-18780115 11:18780136-18780158
Sequence CCAGGCAGTGCCATCAGCTACAA CAGGCTCTGTCAGGTGTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 125} {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!