ID: 1079296322_1079296325

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1079296322 1079296325
Species Human (GRCh38) Human (GRCh38)
Location 11:19237882-19237904 11:19237904-19237926
Sequence CCACTTCTGTTGTCAAACAAACC CCCTTTTCTGATCTCTGTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 158} {0: 1, 1: 0, 2: 0, 3: 23, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!