ID: 1079312279_1079312280

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1079312279 1079312280
Species Human (GRCh38) Human (GRCh38)
Location 11:19377569-19377591 11:19377595-19377617
Sequence CCAGTATGCAGCACTGTGCTGAG GACACATATGTGAATATATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 237} {0: 1, 1: 0, 2: 2, 3: 42, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!