ID: 1079328004_1079328008

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1079328004 1079328008
Species Human (GRCh38) Human (GRCh38)
Location 11:19511137-19511159 11:19511176-19511198
Sequence CCAAGTCAGTAGGTTTTGTCAGT GAGAACAGTCGGGAGACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109} {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!