ID: 1079356875_1079356883

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1079356875 1079356883
Species Human (GRCh38) Human (GRCh38)
Location 11:19737119-19737141 11:19737167-19737189
Sequence CCATAAGTGGACAGAAGTTTAGA ACAGGGACTCCTGTGGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144} {0: 1, 1: 0, 2: 3, 3: 11, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!