ID: 1079364215_1079364220

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1079364215 1079364220
Species Human (GRCh38) Human (GRCh38)
Location 11:19794998-19795020 11:19795032-19795054
Sequence CCTACTCAGTACCCTATGGAGTA TGGCTTCCTTTCCCAGGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75} {0: 1, 1: 0, 2: 3, 3: 20, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!