ID: 1079378840_1079378842

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1079378840 1079378842
Species Human (GRCh38) Human (GRCh38)
Location 11:19918903-19918925 11:19918922-19918944
Sequence CCTTCCTTCTGCTTTATGCTCTG TCTGTTTCATCCCCAAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 511} {0: 1, 1: 0, 2: 1, 3: 16, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!