ID: 1079379154_1079379156

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1079379154 1079379156
Species Human (GRCh38) Human (GRCh38)
Location 11:19921789-19921811 11:19921836-19921858
Sequence CCTACCTCATTGGATTTATAGCA AAAATGCTTAGCACTGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168} {0: 2, 1: 25, 2: 186, 3: 822, 4: 2650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!