|
Left Crispr |
Right Crispr |
| Crispr ID |
1079391424 |
1079391428 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:20025124-20025146
|
11:20025164-20025186
|
| Sequence |
CCCTGGCACCTTGGGCAGGTCAC |
CAGTTTCCACATCTATCCAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 11, 3: 106, 4: 544} |
{0: 1, 1: 4, 2: 65, 3: 858, 4: 4362} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|