ID: 1079395292_1079395297

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1079395292 1079395297
Species Human (GRCh38) Human (GRCh38)
Location 11:20057082-20057104 11:20057095-20057117
Sequence CCCTTTGTTGCCATTGAAAAAGC TTGAAAAAGCAGAATGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 219} {0: 1, 1: 0, 2: 6, 3: 56, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!