ID: 1079400875_1079400877

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1079400875 1079400877
Species Human (GRCh38) Human (GRCh38)
Location 11:20105478-20105500 11:20105512-20105534
Sequence CCATCATTTGGATCACCATCATC TGTTTCTGACTTCCTCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 79, 4: 783} {0: 1, 1: 0, 2: 3, 3: 27, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!