ID: 1079402652_1079402666

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1079402652 1079402666
Species Human (GRCh38) Human (GRCh38)
Location 11:20118306-20118328 11:20118354-20118376
Sequence CCTGCATCCCCCACATCACCCTG AGCCACAGCCTTAGAGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 510} {0: 1, 1: 0, 2: 3, 3: 28, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!