ID: 1079416057_1079416063

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1079416057 1079416063
Species Human (GRCh38) Human (GRCh38)
Location 11:20237780-20237802 11:20237808-20237830
Sequence CCCTTCTGTCTTCTCTCCCCTTT GGCAGAACAACCTCTCCCAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!