ID: 1079460175_1079460183

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079460175 1079460183
Species Human (GRCh38) Human (GRCh38)
Location 11:20671442-20671464 11:20671495-20671517
Sequence CCTAAATCCTTTGTTCTCATTAC CACGGAATGGAACGTGTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 44, 4: 318} {0: 1, 1: 0, 2: 0, 3: 6, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!