ID: 1079471522_1079471530

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1079471522 1079471530
Species Human (GRCh38) Human (GRCh38)
Location 11:20782657-20782679 11:20782707-20782729
Sequence CCCATGTAGTCCTGGAGAAATAA GATGGTCAGGATGTGAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 131} {0: 1, 1: 0, 2: 2, 3: 30, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!