ID: 1079473998_1079474009

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079473998 1079474009
Species Human (GRCh38) Human (GRCh38)
Location 11:20808797-20808819 11:20808850-20808872
Sequence CCCACAATCATTGTACTCCCTCT TGGCTGCTGCTGGGGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 202} {0: 1, 1: 3, 2: 24, 3: 112, 4: 830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!