ID: 1079478488_1079478493

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1079478488 1079478493
Species Human (GRCh38) Human (GRCh38)
Location 11:20857088-20857110 11:20857111-20857133
Sequence CCCTGCTGATGCTGTGCATACAG CATGCATCCAGAGGGAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 39, 4: 209} {0: 1, 1: 0, 2: 0, 3: 30, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!