ID: 1079523276_1079523285

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079523276 1079523285
Species Human (GRCh38) Human (GRCh38)
Location 11:21354346-21354368 11:21354399-21354421
Sequence CCTCCCTCCTTCTTTCTACTCTC TCAAACCAGGTTTCTCTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 252, 4: 1937} {0: 1, 1: 0, 2: 0, 3: 16, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!