ID: 1079615630_1079615631

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1079615630 1079615631
Species Human (GRCh38) Human (GRCh38)
Location 11:22489162-22489184 11:22489184-22489206
Sequence CCATTCTAGAGAAGTCTTAGATG GAAAATGAGAAACATATTATTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 28, 3: 125, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!