ID: 1079633170_1079633173

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1079633170 1079633173
Species Human (GRCh38) Human (GRCh38)
Location 11:22702784-22702806 11:22702818-22702840
Sequence CCTATTCTGTACTCTGCTGAGAA CAGAGCAAGGAGAAGAGATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 229} {0: 1, 1: 0, 2: 2, 3: 63, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!