ID: 1079642817_1079642822

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1079642817 1079642822
Species Human (GRCh38) Human (GRCh38)
Location 11:22828604-22828626 11:22828618-22828640
Sequence CCAAGCAGTGAGCCGTGTGGTTA GTGTGGTTATCAAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97} {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!