ID: 1079738258_1079738261

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1079738258 1079738261
Species Human (GRCh38) Human (GRCh38)
Location 11:24024930-24024952 11:24024953-24024975
Sequence CCCACAACTGTAAAGGAGGGACT CCTCCCTTACTCATTTTATGAGG
Strand - +
Off-target summary No data {0: 24, 1: 8671, 2: 4336, 3: 2089, 4: 1748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!