ID: 1079790235_1079790236

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1079790235 1079790236
Species Human (GRCh38) Human (GRCh38)
Location 11:24728409-24728431 11:24728428-24728450
Sequence CCTGCTTCTGCTCTAGTTAGGCC GGCCAGCGTAATCTTTTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114} {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!