|
Left Crispr |
Right Crispr |
| Crispr ID |
1079798923 |
1079798931 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:24844731-24844753
|
11:24844761-24844783
|
| Sequence |
CCCAGCCACTCCAGTCATGGCTG |
CCAACATAGAACTCGGGCCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 156, 2: 266, 3: 616, 4: 974} |
{0: 1, 1: 17, 2: 82, 3: 177, 4: 431} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|