ID: 1079827374_1079827377

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1079827374 1079827377
Species Human (GRCh38) Human (GRCh38)
Location 11:25214071-25214093 11:25214084-25214106
Sequence CCCAGTCTTAGGTATTTCTTCGT ATTTCTTCGTAGCAGTATGAGGG
Strand - +
Off-target summary {0: 2, 1: 49, 2: 1233, 3: 4260, 4: 12468} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!