ID: 1079854760_1079854761

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1079854760 1079854761
Species Human (GRCh38) Human (GRCh38)
Location 11:25588656-25588678 11:25588669-25588691
Sequence CCACTCTGCTTCTGATCATAGCG GATCATAGCGCCTCTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 2, 3: 9, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!