ID: 1079869521_1079869524

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1079869521 1079869524
Species Human (GRCh38) Human (GRCh38)
Location 11:25780588-25780610 11:25780601-25780623
Sequence CCCCAGCACAGTGTAGCCACCCC TAGCCACCCCCATGAAAACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 237} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!