ID: 1079869521_1079869536

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079869521 1079869536
Species Human (GRCh38) Human (GRCh38)
Location 11:25780588-25780610 11:25780641-25780663
Sequence CCCCAGCACAGTGTAGCCACCCC TGGGTTCACTTCTTACTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!