ID: 1079916580_1079916588

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1079916580 1079916588
Species Human (GRCh38) Human (GRCh38)
Location 11:26375330-26375352 11:26375375-26375397
Sequence CCCGGTTCCTAACAGACCATGGA GAGTTAAGGACCTTGGTATAAGG
Strand - +
Off-target summary {0: 16, 1: 237, 2: 671, 3: 1125, 4: 1290} {0: 1, 1: 0, 2: 0, 3: 19, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!