ID: 1079967851_1079967856

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1079967851 1079967856
Species Human (GRCh38) Human (GRCh38)
Location 11:27000908-27000930 11:27000958-27000980
Sequence CCCTTTCTGAAGGCAGTAGACTG ATTCTAGGATTGATGATAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!