ID: 1080013784_1080013788

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1080013784 1080013788
Species Human (GRCh38) Human (GRCh38)
Location 11:27483946-27483968 11:27483985-27484007
Sequence CCAGCACACCAAGTACATTTGCT CAAGATGAAGAGATGAGCTACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 10, 4: 138} {0: 1, 1: 1, 2: 3, 3: 39, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!