ID: 1080034983_1080035003

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1080034983 1080035003
Species Human (GRCh38) Human (GRCh38)
Location 11:27700784-27700806 11:27700825-27700847
Sequence CCCGGGGAACCCCGCGTCCCGCG GCTGTGGGCGCTGGGGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89} {0: 1, 1: 0, 2: 11, 3: 103, 4: 1026}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!