ID: 1080044475_1080044480

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1080044475 1080044480
Species Human (GRCh38) Human (GRCh38)
Location 11:27794824-27794846 11:27794872-27794894
Sequence CCTGAGACTGGATAATTTATAAG TTCTGCAGGCTATACAAGGATGG
Strand - +
Off-target summary {0: 34, 1: 1122, 2: 8813, 3: 14799, 4: 14305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!