ID: 1080057593_1080057600

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1080057593 1080057600
Species Human (GRCh38) Human (GRCh38)
Location 11:27923232-27923254 11:27923275-27923297
Sequence CCTCTTTTTTTTTTAACCTTATA CAGGATTCCATGGGTTCTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 235, 4: 1649} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!