ID: 1080074591_1080074601

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1080074591 1080074601
Species Human (GRCh38) Human (GRCh38)
Location 11:28134371-28134393 11:28134387-28134409
Sequence CCACCCCATTCCCCCGTGCGTAT TGCGTATGTGGGCTCTTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98} {0: 1, 1: 0, 2: 0, 3: 33, 4: 863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!