ID: 1080133210_1080133218

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1080133210 1080133218
Species Human (GRCh38) Human (GRCh38)
Location 11:28820627-28820649 11:28820650-28820672
Sequence CCCTCTGTCCTATAGAGAAGCCC ACTTAGCAAGGAACTAAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 34, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!