ID: 1080206810_1080206814

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1080206810 1080206814
Species Human (GRCh38) Human (GRCh38)
Location 11:29738818-29738840 11:29738854-29738876
Sequence CCAGCTTGTAGCAACTTTAGTTC CAGGTCAGCTTCTGGATGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 44, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!