ID: 1080231116_1080231119

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1080231116 1080231119
Species Human (GRCh38) Human (GRCh38)
Location 11:30017944-30017966 11:30017965-30017987
Sequence CCAAGAAAAAAAAAAGTGGGCTG TGTTCCTCGAAGTCAGGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!