ID: 1080240510_1080240516

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1080240510 1080240516
Species Human (GRCh38) Human (GRCh38)
Location 11:30122031-30122053 11:30122074-30122096
Sequence CCCCTTTTAGGATCTTCTTGGCA ATGCATTTTGATCTGCTGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!