ID: 1080272566_1080272576

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1080272566 1080272576
Species Human (GRCh38) Human (GRCh38)
Location 11:30466513-30466535 11:30466556-30466578
Sequence CCTTCAGGGATCGCTGGACCCTA CCTTTGATGCAGAGGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76} {0: 1, 1: 0, 2: 1, 3: 14, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!