ID: 1080281498_1080281504

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1080281498 1080281504
Species Human (GRCh38) Human (GRCh38)
Location 11:30562626-30562648 11:30562646-30562668
Sequence CCCCAAACTGTAAGTTCCTTAGG AGGCACCTACAGCTTATTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 181} {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!