ID: 1080314746_1080314750

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1080314746 1080314750
Species Human (GRCh38) Human (GRCh38)
Location 11:30936219-30936241 11:30936258-30936280
Sequence CCATAGTAGGAAGATCTGTAGCC GTCCATATAATAACTCATAGAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 10, 3: 11, 4: 79} {0: 1, 1: 5, 2: 11, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!