ID: 1080314746_1080314751

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1080314746 1080314751
Species Human (GRCh38) Human (GRCh38)
Location 11:30936219-30936241 11:30936259-30936281
Sequence CCATAGTAGGAAGATCTGTAGCC TCCATATAATAACTCATAGAGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 10, 3: 11, 4: 79} {0: 1, 1: 1, 2: 4, 3: 26, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!