ID: 1080318999_1080319001

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1080318999 1080319001
Species Human (GRCh38) Human (GRCh38)
Location 11:30984666-30984688 11:30984682-30984704
Sequence CCCGTGACTTTAAGAAGCAGCTG GCAGCTGTTTAGTTGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 216} {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!